Adapter trimming
It is important to state that MPRAsnakeflow requires the core information as input. This means that reads should not have unnecessary sequences left and right of barcodes, oligos or UMIs. There is no difference between the assignment and experiment workflows. There are only two exceptions.
Within the assignment workflow, it is possible that the barcode and the oligo can be within one read separated by a spacer with a fixed sequence or length. This can be defined within the config file; see Config File. Use it without a barcode read and the option
linker_lengthorlinker.Within the experiment workflow, when single-end reads are used (only FWD or FWD + UMI), it retrieves the barcode from the first N positions of the read, no matter how long the read is. It can also be the last N positions by using the option
bc_extraction: end(default isstart; see Config File).
Otherwise, you have to trim your reads to run the workflow. Since MPRAsnakeflow version 0.6.0, we provide an optional adapter trimming step using Cutadapt (before it was only supported partially within the assignment step). You can enable it by setting the config option adapters: {<READ_TYPE>: ...} in both the experiment and assignment workflows. By default, no adapters are trimmed.
Note
Adapter trimming can only be used when all reads of a certain type (FWD, REV, UMI, BC) have the same adapters. For example, when you sequenced FWD and REV twice, once each with 150bp and once with 151bp, you might need to remove adapters of different lengths between the two runs. This is currently not supported but can be done manually before running MPRAsnakeflow. See GSE174534 (Abell et al. Complex Read Structure) for an example where this is exactly the case within the assignment workflow.
Also, it is not possible to trim adapters differently for DNA and RNA counts. For FWD (or REV) count reads, they have to be processed in the same way.
We use the adapter trimming option in two examples: GSE174534 (Abell et al. Complex Read Structure) and ENCODE data (Gosai et al. Plasmid based) if you want to see real examples.
Configure adapter trimming
This is done via the config file. You can specify adapters for each read type (FWD, REV, UMI, BC) separately. You can use one of two options:
Specify a sequence length for trimming (5’ and/or 3’ end)
Specify the actual adapter sequences to be trimmed (5’ and/or 3’ end; multiple adapter sequences allowed)
Both options cannot be used together for one read type.
As an example, we want to trim the first 5 and the last 10 bases from a FWD read:
adapters:
FWD:
- 5
- -10
You see we just name the read type (FWD) and provide a list with two entries. Positive entries indicate trimming from the start (5’ end) and negative numbers indicate trimming from the end (3’ end). This is equal to the -u option in Cutadapt.
When we want to use the exact sequence of an adapter, we can use a config like this. Now we trim the start of the FWD and REV reads as well as the end of the BC read with specific sequences:
adapters:
FWD:
five_prime:
- AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
- AGATCGGTCGAAADT
REV:
five_prime:
- AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
BC:
three_prime:
- ACACTCTTTCCCTACACGACGCTCTTCCGATCT