Assignment

_images/MPRAsnakeflow_assignment_overview.png

Input files

Fastq Files

  • 2-3 Fastq files from library association sequencing

  • Candidate regulatory sequence (CRS) sequencing, forward and reverse read (paired end)

  • (optional) Index read with barcode. BC can also be present at the beginning of the in the forward read followed by a linker.

Design File

Multi-Fasta file of of CRS sequences with unique headers describing each tested sequence

Example file:

>CRS1
GACGGGAACGTTTGAGCGAGATCGAGGATAGGAGGAGCGGA
>CRS2
GGGCTCTCTTATATTAAGGGGGTGTGTGAACGCTCGCGATT
>CRS3
GGCGCGCTTTTTCGAAGAAACCCGCCGGAGAATATAAGGGA
>CRS4
TTAGACCGCCCTTTACCCCGAGAAAACTCAGCTACACACTC

Note

Headers of the design file must be unique (before any space), cannot contain [ or ] and should not contain duplicated sequences (forward and antisense).

Config File

Multiple mapping strategies are implemented to find the corresponding CRS sequence for each read. The mapping strategy can be chosen in the config file (bbmap, bwa mem or exact matches). The config file also defines the filtering of the mapping results and is is a yaml file.

Example of an assignment file using bbmap and the standard filtering (we reccommend to use bbmap as default):

---
version: "0.3"
assignments:
  exampleAssignment: # name of an example assignment (can be any string)
    bc_length: 15
    alignment_tool:
      split_number: 1 # number of files fastq should be split for parallelization
      tool: bbmap
      configs:
        min_mapping_quality: 30 # 30 is default for bbmap
        sequence_length: 171 # sequence length of design excluding adapters.
        alignment_start: 1 # start of an alignment in the reference/design_file. Here using 15 bp adapters. Can be different when using adapter free approaches
    FW:
      - resources/Assignment_BasiC/R1.fastq.gz
    BC:
      - resources/Assignment_BasiC/R2.fastq.gz
    REV:
      - resources/Assignment_BasiC/R3.fastq.gz
    design_file: resources/design.fa
    configs:
      default: {} # name of an example filtering config

Example of an assignment file using bwa and the standard filtering:

---
version: "0.3"
assignments:
  exampleAssignment: # name of an example assignment (can be any string)
    bc_length: 15
    alignment_tool:
      split_number: 1 # number of files fastq should be split for parallelization
      tool: bwa
      configs:
        min_mapping_quality: 1 # integer >=0 Please use 1 when you have oligos that differ by 1 base in your reference/design_file
        sequence_length: # sequence length of design excluding adapters.
          min: 166
          max: 175
        alignment_start: # start of an alignment in the reference/design_file. Here using 15 bp adapters. Can be different when using adapter free approaches
          min: 1 # integer
          max: 3 # integer
    FW:
      - resources/Assignment_BasiC/R1.fastq.gz
    BC:
      - resources/Assignment_BasiC/R2.fastq.gz
    REV:
      - resources/Assignment_BasiC/R3.fastq.gz
    design_file: resources/design.fa
    configs:
      default: {} # name of an example filtering config

Example of an assignment file using exact matches and the with and non-default filtering of barcodes:

---
version: "0.3"
assignments:
  exampleAssignment: # name of an example assignment (can be any string)
    bc_length: 15
    alignment_tool:
      split_number: 1 # number of files fastq should be split for parallelization
      tool: exact # bwa or exact
      configs:
        sequence_length: 171 # sequence length of design excluding adapters.
        alignment_start: 1 # start of the alignment in the reference/design_file
    FW:
      - resources/Assignment_BasiC/R1.fastq.gz
    BC:
      - resources/Assignment_BasiC/R2.fastq.gz
    REV:
      - resources/Assignment_BasiC/R3.fastq.gz
    design_file: resources/design.fa
    configs:
      lazy: # name of an example filtering config
        min_support: 2 # default 3
        fraction: 0.6 # default 0.75

Example of an assignment file using exact matches and read 1 with BC, linker and oligo (no seperate BC index read):

---
version: "0.3"
assignments:
  exampleAssignment: # name of an example assignment (can be any string)
    bc_length: 20
    BC_rev_comp: true
    linker: TCTAGACCGTCACTAACTAACAGTGGGTACCC
    alignment_tool:
      split_number: 1 # number of files fastq should be split for parallelization
      tool: exact # bwa or exact
      configs:
        sequence_length: 171 # sequence length of design excluding adapters.
        alignment_start: 1 # start of the alignment in the reference/design_file
    FW:
      - resources/Assignment_BasiC/R1.fastq.gz
    REV:
      - resources/Assignment_BasiC/R3.fastq.gz
    design_file: resources/design.fa
    configs:
      default: {} # name of an example filtering config

If you want to use the strand sensitivity option (e.g. testing enhancer in both directions), you can add the following to the config file: strand_sensitive: {enable: true}. Otherwise, MPRAsnakeflow will give you an error because it cannot handle the same sequences in both sense and antisense directions. This is an issue with the mappers because they do not consider the strand and will always call your read ambiguous due to multiple matches.

snakemake

Options

With --help or -h you can see the help message.

Mandatory arguments:
--cores:

Use at most N CPU cores/jobs in parallel. If N is omitted or ‘all’, the limit is set to the number of available CPU cores. In case of cluster/cloud execution, this argument sets the number of total cores used over all jobs (made available to rules via workflow.cores).(default: None)

--configfile:

Specify or overwrite the config file of the workflow (see the docs). Values specified in JSON or YAML format are available in the global config dictionary inside the workflow. Multiple files overwrite each other in the given order. Thereby missing keys in previous config files are extended by following configfiles. Note that this order also includes a config file defined in the workflow definition itself (which will come first). (default: None)

--sdm:

Required to run MPRAsnakeflow. : --sdm conda or --sdm apptainer conda Uses the defined conda environment per rule. We highly recommend to use apptainer where we build a predefined docker container with all software installewd within it. --sdm conda teh conda envs will be installed by the first excecution of the workflow. If this flag is not set, the conda/apptainer directive is ignored. (default: False)

Recommended arguments:
--snakefile:

You should not need to specify this. By default, Snakemake will search for ‘Snakefile’, ‘snakefile’, ‘workflow/Snakefile’,’workflow/snakefile’ beneath the current working directory, in this order. Only if you definitely want a different layout, you need to use this parameter. This is very usefull when you want to have the results in a different folder than MPRAsnakeflow is in. (default: None)

Usefull arguments:
-n:

Do not execute anything, and display what would be done. If you have a very large workflow, use –dry-run –quiet to just print a summary of the DAG of jobs. (default: False)

--touch, -t:

Touch output files (mark them up to date without really changing them) instead of running their commands. This is used to pretend that the rules were executed, in order to fool future invocations of snakemake. Fails if a file does not yet exist. Note that this will only touch files that would otherwise be recreated by Snakemake (e.g. because their input files are newer). For enforcing a touch, combine this with –force, –forceall, or –forcerun. Note however that you loose the provenance information when the files have been created in realitiy. Hence, this should be used only as a last resort. (default: False)

Rules

Rules run by snakemake in the assignment utility.

all

The overall all rule. Here is defined what final output files are expected.

all_assignments

Run all steps of the assignmenmt workflow.

assignment_attach_idx

Extract the index sequence and add it to the header.

assignment_collect

Collect mapped reads into one BAM.

assignment_collectBCs

Get the barcodes.

assignment_fastq_split

Split the fastq files into n files for parallelisation. N is given by split_read in the configuration file.

assignment_filter

Filter the barcodes file based on the config given in the config-file. Results for this run are here results/assignment/<assignment_name>/assignment_barcodes.<config_name>.tsv.gz.

assignment_flagstat

Run samtools flagstat. Results are in results/assignment/<assignment_name>/statistic/assignment/bam_stats.txt (code:bwa or code:bbmap mapping approach).

assignment_hybridFWRead_get_reads_by_length

Get the barcode and read from the FW read using fixed length (when no index BC read is present).

assignment_hybridFWRead_get_reads_by_cutadapt

Get the barcode and read from the FW read using cutadapt (when no index BC read is present). Uses the paired end mode of cutadapt to write the FW and BC read.

assignment_idx_bam

Index the BAM file (code:bwa or code:bbmap mapping approach).

assignment_mapping_bbmap

Map the reads to the reference (code:bbmap mapping approach).

assignment_mapping_bbmap_getBCs

Get the barcodes based on mapq in the mapping file of bbmap.

assignment_mapping_bwa

Map the reads to the reference (code:bwa mapping approach).

assignment_mapping_bwa_getBCs

Get the barcodes based on mapq, min/max sequence startd and min/max sequence length in the mapping file of bwa.

assignment_mapping_bwa_ref

Create mapping reference for BWA from design file (code:bwa mapping approach).

assignment_mapping_exact_reference

Create reference to map the exact design (code:exact mapping approach).

assignment_mapping_exact

Map the reads to the reference and sort using exact match (code:exact mapping approach).

assignment_merge

Merge the FW,REV and BC fastq files into one. Extract the index sequence from the middle and end of an Illumina run. Separates reads for Paired End runs. Merge/Adapter trim reads stored in BAM.

assignment_statistic_assignedCounts

Statistic of filtered the assigned counts. Result is here results/assignment/<assignment_name>/statistic/assigned_counts.<config_name>.tsv.

assignment_statistic_assignment

Statistic of the filtered assignment. Result is here results/assignment/<assignment_name>/statistic/assignment.<config_name>.tsv.gz and a plot here results/assignment/<assignment_name>/statistic/assignment.<config_name>.png.

assignment_statistic_totalCounts

Statistic of the total (unfiltered counts). Results are in results/assignment/<assignment_name>/statistic/total_counts.tsv

Output

The output can be found in the folder defined by the option results/assignment/. It is structured in folders of the condition as

Files

Once the pipline is finished running then all the output files can be seen in the results folder. This pipline also generates a qc report. For more details, refer to the HTML QC report.

File tree of the result folder (names in < > can be specified in the config file.)

├── assignment
└── <assignment_name>
    ├── BCs
    ├── aligned_merged_reads.bam
    ├── aligned_merged_reads.bam.bai
    ├── assignment_barcodes.default.tsv.gz
    ├── assignment_barcodes_with_ambigous.default.tsv.gz
    ├── barcodes_incl_other.tsv.gz
    ├── bbmap
    ├── design_check.done
    ├── design_check.err
    ├── fastq
    │   └── splits
    ├── qc_report.default.html
    ├── reference
    │   └── reference.fa
    └── statistic
        ├── assigned_counts.default.tsv
        ├── assignment
        │   └── bam_stats.txt
        ├── assignment.default.png
        ├── assignment.default.tsv.gz
        └── total_counts.tsv
qc_report.default.html

QC report of the assignment!

total_counts.tsv

Raw statistic of BCs mapped to oligos (number of observerd BCs and Oligos).

assigned_counts.<config_name>.tsv

Statistic of BCs mapped to oligos after fitering defined by config.

assignment.<config_name>.tsv.gz

Average/median support of BC per oligo. Oligos with >= 15 BCs.

reference.fa

Design file.

aligned_merged_reads.bam

Sorted bamfile for oligo alignment

barcodes_incl_other.tsv.gz

Complete list of all barcodes found in mapping file (ambigous and unambigous) with mappings (if possible)

assignment_barcodes.<config_name>.tsv.gz

Mapping file of barcodes to sequence. Can be used as input for the experiment workflow.

assignment_barcodes_with_ambigous.<config_name>.tsv.gz

Mapping file of barcodes to sequence including ambigous and other observed barcodes.

assignment.<config_name>.png

Visualization of number of barcodes mapping to oligo.

bam_stats.txt

samtools bamstat output.

design_check.done and design_check.err

Chek files if the design fasta has correct headers and no duplicated sequences (sense and antisense)